|
TaKaRa
guide ittm ivt rna clean up kit Guide Ittm Ivt Rna Clean Up Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/guide ittm ivt rna clean up kit/product/TaKaRa Average 95 stars, based on 1 article reviews
guide ittm ivt rna clean up kit - by Bioz Stars,
2026-03
95/100 stars
|
Buy from Supplier |
|
Addgene inc
pre amplified Pre Amplified, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pre amplified/product/Addgene inc Average 92 stars, based on 1 article reviews
pre amplified - by Bioz Stars,
2026-03
92/100 stars
|
Buy from Supplier |
|
Illumina Inc
truseq small rna sample preparation guide Truseq Small Rna Sample Preparation Guide, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/truseq small rna sample preparation guide/product/Illumina Inc Average 99 stars, based on 1 article reviews
truseq small rna sample preparation guide - by Bioz Stars,
2026-03
99/100 stars
|
Buy from Supplier |
|
Addgene inc
cdr1as sequence ![]() Cdr1as Sequence, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/cdr1as sequence/product/Addgene inc Average 93 stars, based on 1 article reviews
cdr1as sequence - by Bioz Stars,
2026-03
93/100 stars
|
Buy from Supplier |
|
MACHEREY NAGEL
guide rna plasmid nucleospin plasmid transfection-grade ![]() Guide Rna Plasmid Nucleospin Plasmid Transfection Grade, supplied by MACHEREY NAGEL, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/guide rna plasmid nucleospin plasmid transfection-grade/product/MACHEREY NAGEL Average 90 stars, based on 1 article reviews
guide rna plasmid nucleospin plasmid transfection-grade - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
BioRay Inc
single-guide rna (sgrna) designed to target ripk3 kinase domain ![]() Single Guide Rna (Sgrna) Designed To Target Ripk3 Kinase Domain, supplied by BioRay Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/single-guide rna (sgrna) designed to target ripk3 kinase domain/product/BioRay Inc Average 90 stars, based on 1 article reviews
single-guide rna (sgrna) designed to target ripk3 kinase domain - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
GenScript corporation
custom guide rna library ![]() Custom Guide Rna Library, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/custom guide rna library/product/GenScript corporation Average 90 stars, based on 1 article reviews
custom guide rna library - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Synthego Inc
single-guide rnas ![]() Single Guide Rnas, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/single-guide rnas/product/Synthego Inc Average 90 stars, based on 1 article reviews
single-guide rnas - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Shanghai Model Organisms Center
pc3-u6-guide rna-cmvred plasmid ![]() Pc3 U6 Guide Rna Cmvred Plasmid, supplied by Shanghai Model Organisms Center, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pc3-u6-guide rna-cmvred plasmid/product/Shanghai Model Organisms Center Average 90 stars, based on 1 article reviews
pc3-u6-guide rna-cmvred plasmid - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Benchling Inc
guide rna benchling ![]() Guide Rna Benchling, supplied by Benchling Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/guide rna benchling/product/Benchling Inc Average 90 stars, based on 1 article reviews
guide rna benchling - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
GenScript corporation
rnase1 crispr guide rna (target sequence: tgccaagggctcatgcacga) ![]() Rnase1 Crispr Guide Rna (Target Sequence: Tgccaagggctcatgcacga), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/rnase1 crispr guide rna (target sequence: tgccaagggctcatgcacga)/product/GenScript corporation Average 90 stars, based on 1 article reviews
rnase1 crispr guide rna (target sequence: tgccaagggctcatgcacga) - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Biomatters Ltd
single guide rna (sgrna) ![]() Single Guide Rna (Sgrna), supplied by Biomatters Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/single guide rna (sgrna)/product/Biomatters Ltd Average 90 stars, based on 1 article reviews
single guide rna (sgrna) - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Mediators of Inflammation
Article Title: circRNA CDR1as Regulated the Proliferation of Human Periodontal Ligament Stem Cells under a Lipopolysaccharide-Induced Inflammatory Condition
doi: 10.1155/2019/1625381
Figure Lengend Snippet: The expression levels of CDR1as in periodontal ligament tissues and PDLSCs. (a) The expression of CDR1as in normal tissues ( n = 11) and periodontitis tissues ( n = 10) was determined by RT-qPCR. ∗ p < 0.01 vs. normal. (b) The TNF- α protein level secreted in the medium by PDLSCs treated with LPS was measured with an ELISA kit. Untreated PDLSCs (0 h) were used as control. ∗ p < 0.01 vs. control, ∗∗ p < 0.05 vs. 3 h. (c) IL-8 and IL-18 protein levels secreted in the medium by PDLSCs treated with LPS at 10 μ g/ml for 3 h were measured with an ELISA kit. Untreated PDLSCs were used as control. ∗ p < 0.01 vs. control. (d) The expression levels of CDR1as in LPS-treated PDLSCs were analyzed by RT-qPCR. Untreated PDLSCs were used as control. ∗ p < 0.01 vs. control.
Article Snippet: The expression plasmid for expressing
Techniques: Expressing, Quantitative RT-PCR, Enzyme-linked Immunosorbent Assay, Control
Journal: Mediators of Inflammation
Article Title: circRNA CDR1as Regulated the Proliferation of Human Periodontal Ligament Stem Cells under a Lipopolysaccharide-Induced Inflammatory Condition
doi: 10.1155/2019/1625381
Figure Lengend Snippet: circRNA CDR1as mediated LPS-induced inhibition of PDLSC proliferation. (a) A standard curve of cell proliferation and mathematical formula describing OD value and cell number. Cell proliferation of PDLSCs was assessed by CCK-8 assay as indicated with cell numbers in reference to this standard curve obtained under the same conditions in all subsequent experiments. (b) Cell number of LPS-treated PDLSCs was less than that of untreated cells at each examined day, ∗ p < 0.01. (c) The efficiency of knockdown of CDR1as in PDLSCs was determined by RT-qPCR. ∗ p < 0.01 vs. si-NC. (d) The effects of knockdown of CDR1as on the proliferation of PDLSCs. ∗ p < 0.01 vs. control. (e) The efficiency of overexpression of CDR1as in PDLSCs was determined by RT-qPCR. ∗ p < 0.01 vs. over-NC. (f) The effects of overexpression of CDR1as on the proliferation of PDLSCs, ∗ p < 0.01 vs. control.
Article Snippet: The expression plasmid for expressing
Techniques: Inhibition, CCK-8 Assay, Knockdown, Quantitative RT-PCR, Control, Over Expression
Journal: Mediators of Inflammation
Article Title: circRNA CDR1as Regulated the Proliferation of Human Periodontal Ligament Stem Cells under a Lipopolysaccharide-Induced Inflammatory Condition
doi: 10.1155/2019/1625381
Figure Lengend Snippet: CDR1as/miR-7 regulated LPS-induced inhibition of PDLSC proliferation by targeting ERK. (a) The efficiency of transient transduction of miR-7 mimics and miR-7 inhibitor evaluated by RT-qPCR. ∗ p < 0.01 vs. miR-NC. (b) The effects of miR-1 mimic and inhibitor on the proliferation of PDLSCs. After being transfected with miR-NC, miR-7 mimic, or miR-7 inhibitor, PDLSCs were treated with LPS at 10 ng/ μ l for 3 h and cultured for another 3 days with an initial seeding density of 2000 cell/well. Cell proliferation was evaluated by CCK-8 kits. ∗ p < 0.01 vs. miR-NC. (c) Western blot analysis of the protein expression of phospho-ERK, total-ERK, and the internal control GAPDH after transfection with miR-7 mimic, miR-7 inhibitor, or miR-NC. ∗ p < 0.01 vs. miR-NC. (d) Western blot analysis of the protein expression of phospho-ERK, total-ERK, and the internal control GAPDH after transfection with siRNA-CDR1as alone or cotransfected with miR-7 inhibit or miR-7 mimic. ∗ p < 0.01 vs. siRNA-CDR1as. (e) The effects of siRNA-CDR1as cotransfected with miR-7 inhibit or miR-7 mimic on the cell proliferation of PDLSCs. ∗ p < 0.05 vs. siRNA-CDR1as.
Article Snippet: The expression plasmid for expressing
Techniques: Inhibition, Transduction, Quantitative RT-PCR, Transfection, Cell Culture, CCK-8 Assay, Western Blot, Expressing, Control