guide rna Search Results


94
PackGene Biotech lnc plv lenti efs hspcas9 u6 sgrna
Plv Lenti Efs Hspcas9 U6 Sgrna, supplied by PackGene Biotech lnc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/guide+rna/Custom+sgRNA/pmc09184653-291-9-13
Average 94 stars, based on 1 article reviews
plv lenti efs hspcas9 u6 sgrna - by Bioz Stars, 2026-10
94/100 stars
  Buy from Supplier

92
Addgene inc paired guide rna pgrna library pool library pool
lncRNA dropout CRISPR-Cas9 screen in MM cell lines. (A) Schematic representation of the CRISPR screening pipeline. (B) Spearman's correlation between <t>pgRNA</t> read count profiles (from DNA collected 30 days after transduction and selection of the library) across screen replicates = 0.85 and 0.88, respectively, for AMO-1 and ABZB, with color bars on top/left indicating cluster membership obtained via hierarchical clustering (complete distance method). (C) Representation of pgRNA abundance log fold changes (logFCs) in DNA collected 30 days after library transduction and selection vs plasmidic amounts for 3 groups of pgRNAs: nontargeting (negative controls [median logFC = 0.27 and 0.35, respectively, for AMO-1 and ABZB]), targeting ribosomal protein genes (control essential genes, median logFC = −0.68 and −0.43, with a logFC ≤−0.5, corresponding to a MAGeCK FDR ≤20%), and lncRNAs, across the 2 screens. Each point represents 1 of the 12 472 pgRNAs in the library with coordinates on the y-axis indicating the median logFC across screen replicates. (D) Gene-wise MAGeCK robust rank aggregation (RRA) scores for significant dependencies identified in the 2 screens at an FDR ≤20%. Top essential control genes, dependencies that are private to each cell line and shared across them (as per the color scheme) are highligted. (E) Number of significantly essential lncRNAs (at an FDR ≤20%) in the 2 screened cell lines and their overlap. MOI, multiplicity of infection.
Paired Guide Rna Pgrna Library Pool Library Pool, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/guide+rna/Human+paired-guide+RNA+(pgRNA)+Library+for+long+non-coding+RNAs+(lncRNAs)(Pooled+Library+%2389640)/pmc11522894-28-2-9
Average 92 stars, based on 1 article reviews
paired guide rna pgrna library pool library pool - by Bioz Stars, 2026-10
92/100 stars
  Buy from Supplier

93
Addgene inc cdr1as sequence
The expression levels of <t>CDR1as</t> in periodontal ligament tissues and PDLSCs. (a) The expression of CDR1as in normal tissues ( n = 11) and periodontitis tissues ( n = 10) was determined by RT-qPCR. ∗ p < 0.01 vs. normal. (b) The TNF- α protein level secreted in the medium by PDLSCs treated with LPS was measured with an ELISA kit. Untreated PDLSCs (0 h) were used as control. ∗ p < 0.01 vs. control, ∗∗ p < 0.05 vs. 3 h. (c) IL-8 and IL-18 protein levels secreted in the medium by PDLSCs treated with LPS at 10 μ g/ml for 3 h were measured with an ELISA kit. Untreated PDLSCs were used as control. ∗ p < 0.01 vs. control. (d) The expression levels of CDR1as in LPS-treated PDLSCs were analyzed by RT-qPCR. Untreated PDLSCs were used as control. ∗ p < 0.01 vs. control.
Cdr1as Sequence, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/guide+rna/dSa+Cdr1as+guide+RNA+(Plasmid+%2399681)/pmc06754938-61-5-17
Average 93 stars, based on 1 article reviews
cdr1as sequence - by Bioz Stars, 2026-10
93/100 stars
  Buy from Supplier

90
GenScript corporation custom guide rna library
The expression levels of <t>CDR1as</t> in periodontal ligament tissues and PDLSCs. (a) The expression of CDR1as in normal tissues ( n = 11) and periodontitis tissues ( n = 10) was determined by RT-qPCR. ∗ p < 0.01 vs. normal. (b) The TNF- α protein level secreted in the medium by PDLSCs treated with LPS was measured with an ELISA kit. Untreated PDLSCs (0 h) were used as control. ∗ p < 0.01 vs. control, ∗∗ p < 0.05 vs. 3 h. (c) IL-8 and IL-18 protein levels secreted in the medium by PDLSCs treated with LPS at 10 μ g/ml for 3 h were measured with an ELISA kit. Untreated PDLSCs were used as control. ∗ p < 0.01 vs. control. (d) The expression levels of CDR1as in LPS-treated PDLSCs were analyzed by RT-qPCR. Untreated PDLSCs were used as control. ∗ p < 0.01 vs. control.
Custom Guide Rna Library, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/guide+rna/custom+guide+rna+library/pm39656538-328-3-8
Average 90 stars, based on 1 article reviews
custom guide rna library - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

90
GenScript corporation rnase1 crispr guide rna (target sequence: tgccaagggctcatgcacga)
The expression levels of <t>CDR1as</t> in periodontal ligament tissues and PDLSCs. (a) The expression of CDR1as in normal tissues ( n = 11) and periodontitis tissues ( n = 10) was determined by RT-qPCR. ∗ p < 0.01 vs. normal. (b) The TNF- α protein level secreted in the medium by PDLSCs treated with LPS was measured with an ELISA kit. Untreated PDLSCs (0 h) were used as control. ∗ p < 0.01 vs. control, ∗∗ p < 0.05 vs. 3 h. (c) IL-8 and IL-18 protein levels secreted in the medium by PDLSCs treated with LPS at 10 μ g/ml for 3 h were measured with an ELISA kit. Untreated PDLSCs were used as control. ∗ p < 0.01 vs. control. (d) The expression levels of CDR1as in LPS-treated PDLSCs were analyzed by RT-qPCR. Untreated PDLSCs were used as control. ∗ p < 0.01 vs. control.
Rnase1 Crispr Guide Rna (Target Sequence: Tgccaagggctcatgcacga), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/guide+rna/rnase1+crispr+guide+rna++target+sequence++tgccaagggctcatgcacga+/pm38307859-283-32-48
Average 90 stars, based on 1 article reviews
rnase1 crispr guide rna (target sequence: tgccaagggctcatgcacga) - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

90
BioRay Inc single-guide rna (sgrna) designed to target ripk3 kinase domain
The expression levels of <t>CDR1as</t> in periodontal ligament tissues and PDLSCs. (a) The expression of CDR1as in normal tissues ( n = 11) and periodontitis tissues ( n = 10) was determined by RT-qPCR. ∗ p < 0.01 vs. normal. (b) The TNF- α protein level secreted in the medium by PDLSCs treated with LPS was measured with an ELISA kit. Untreated PDLSCs (0 h) were used as control. ∗ p < 0.01 vs. control, ∗∗ p < 0.05 vs. 3 h. (c) IL-8 and IL-18 protein levels secreted in the medium by PDLSCs treated with LPS at 10 μ g/ml for 3 h were measured with an ELISA kit. Untreated PDLSCs were used as control. ∗ p < 0.01 vs. control. (d) The expression levels of CDR1as in LPS-treated PDLSCs were analyzed by RT-qPCR. Untreated PDLSCs were used as control. ∗ p < 0.01 vs. control.
Single Guide Rna (Sgrna) Designed To Target Ripk3 Kinase Domain, supplied by BioRay Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/guide+rna/single+guide+rna++sgrna++designed+to+target+ripk3+kinase+domain/pm28445730-164-20-23
Average 90 stars, based on 1 article reviews
single-guide rna (sgrna) designed to target ripk3 kinase domain - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

90
VectorBuilder GmbH mammalian crispr lv for a single guide rna (sgrna)
The expression levels of <t>CDR1as</t> in periodontal ligament tissues and PDLSCs. (a) The expression of CDR1as in normal tissues ( n = 11) and periodontitis tissues ( n = 10) was determined by RT-qPCR. ∗ p < 0.01 vs. normal. (b) The TNF- α protein level secreted in the medium by PDLSCs treated with LPS was measured with an ELISA kit. Untreated PDLSCs (0 h) were used as control. ∗ p < 0.01 vs. control, ∗∗ p < 0.05 vs. 3 h. (c) IL-8 and IL-18 protein levels secreted in the medium by PDLSCs treated with LPS at 10 μ g/ml for 3 h were measured with an ELISA kit. Untreated PDLSCs were used as control. ∗ p < 0.01 vs. control. (d) The expression levels of CDR1as in LPS-treated PDLSCs were analyzed by RT-qPCR. Untreated PDLSCs were used as control. ∗ p < 0.01 vs. control.
Mammalian Crispr Lv For A Single Guide Rna (Sgrna), supplied by VectorBuilder GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/guide+rna/mammalian+crispr+lv+for+a+single+guide+rna++sgrna+/pm40659448-263-6-10
Average 90 stars, based on 1 article reviews
mammalian crispr lv for a single guide rna (sgrna) - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

90
FALCO Biosystems Ltd cas9-guide rna directed genome editing
The expression levels of <t>CDR1as</t> in periodontal ligament tissues and PDLSCs. (a) The expression of CDR1as in normal tissues ( n = 11) and periodontitis tissues ( n = 10) was determined by RT-qPCR. ∗ p < 0.01 vs. normal. (b) The TNF- α protein level secreted in the medium by PDLSCs treated with LPS was measured with an ELISA kit. Untreated PDLSCs (0 h) were used as control. ∗ p < 0.01 vs. control, ∗∗ p < 0.05 vs. 3 h. (c) IL-8 and IL-18 protein levels secreted in the medium by PDLSCs treated with LPS at 10 μ g/ml for 3 h were measured with an ELISA kit. Untreated PDLSCs were used as control. ∗ p < 0.01 vs. control. (d) The expression levels of CDR1as in LPS-treated PDLSCs were analyzed by RT-qPCR. Untreated PDLSCs were used as control. ∗ p < 0.01 vs. control.
Cas9 Guide Rna Directed Genome Editing, supplied by FALCO Biosystems Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/guide+rna/cas9+guide+rna+directed+genome+editing/pm29734518-307-22-20
Average 90 stars, based on 1 article reviews
cas9-guide rna directed genome editing - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

90
GenScript corporation mouse non-targeting grna (guide rna) sequence
The expression levels of <t>CDR1as</t> in periodontal ligament tissues and PDLSCs. (a) The expression of CDR1as in normal tissues ( n = 11) and periodontitis tissues ( n = 10) was determined by RT-qPCR. ∗ p < 0.01 vs. normal. (b) The TNF- α protein level secreted in the medium by PDLSCs treated with LPS was measured with an ELISA kit. Untreated PDLSCs (0 h) were used as control. ∗ p < 0.01 vs. control, ∗∗ p < 0.05 vs. 3 h. (c) IL-8 and IL-18 protein levels secreted in the medium by PDLSCs treated with LPS at 10 μ g/ml for 3 h were measured with an ELISA kit. Untreated PDLSCs were used as control. ∗ p < 0.01 vs. control. (d) The expression levels of CDR1as in LPS-treated PDLSCs were analyzed by RT-qPCR. Untreated PDLSCs were used as control. ∗ p < 0.01 vs. control.
Mouse Non Targeting Grna (Guide Rna) Sequence, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/guide+rna/mouse+non+targeting+grna++guide+rna++sequence/pm33197448-108-8-28
Average 90 stars, based on 1 article reviews
mouse non-targeting grna (guide rna) sequence - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

90
Broad Institute Inc short guide rna
The expression levels of <t>CDR1as</t> in periodontal ligament tissues and PDLSCs. (a) The expression of CDR1as in normal tissues ( n = 11) and periodontitis tissues ( n = 10) was determined by RT-qPCR. ∗ p < 0.01 vs. normal. (b) The TNF- α protein level secreted in the medium by PDLSCs treated with LPS was measured with an ELISA kit. Untreated PDLSCs (0 h) were used as control. ∗ p < 0.01 vs. control, ∗∗ p < 0.05 vs. 3 h. (c) IL-8 and IL-18 protein levels secreted in the medium by PDLSCs treated with LPS at 10 μ g/ml for 3 h were measured with an ELISA kit. Untreated PDLSCs were used as control. ∗ p < 0.01 vs. control. (d) The expression levels of CDR1as in LPS-treated PDLSCs were analyzed by RT-qPCR. Untreated PDLSCs were used as control. ∗ p < 0.01 vs. control.
Short Guide Rna, supplied by Broad Institute Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/guide+rna/short+guide+rna/pmc08873596-339-1-21
Average 90 stars, based on 1 article reviews
short guide rna - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

90
ToolGen Incorporated single guide rna (sgrna) including the sequence targeting the neu2 gene
The expression levels of <t>CDR1as</t> in periodontal ligament tissues and PDLSCs. (a) The expression of CDR1as in normal tissues ( n = 11) and periodontitis tissues ( n = 10) was determined by RT-qPCR. ∗ p < 0.01 vs. normal. (b) The TNF- α protein level secreted in the medium by PDLSCs treated with LPS was measured with an ELISA kit. Untreated PDLSCs (0 h) were used as control. ∗ p < 0.01 vs. control, ∗∗ p < 0.05 vs. 3 h. (c) IL-8 and IL-18 protein levels secreted in the medium by PDLSCs treated with LPS at 10 μ g/ml for 3 h were measured with an ELISA kit. Untreated PDLSCs were used as control. ∗ p < 0.01 vs. control. (d) The expression levels of CDR1as in LPS-treated PDLSCs were analyzed by RT-qPCR. Untreated PDLSCs were used as control. ∗ p < 0.01 vs. control.
Single Guide Rna (Sgrna) Including The Sequence Targeting The Neu2 Gene, supplied by ToolGen Incorporated, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/guide+rna/single+guide+rna++sgrna++including+the+sequence+targeting+the+neu2+gene/pmc08881595-32-7-20
Average 90 stars, based on 1 article reviews
single guide rna (sgrna) including the sequence targeting the neu2 gene - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

90
GenScript corporation guide rna sequence
A. Phylogenetic analysis shows the closest homologs of C. elegans CAT-2 (gray) in S. stercoralis (brown) and S. ratti (blue). Putative homologs in each genome were identified by performing TBLASTN searches of the C. elegans CAT-2A <t>protein</t> <t>sequence</t> (i.e ., the longest isoform) against either the S. stercoralis genome or the S. ratti genome in WormBase ParaSite WBPS18. The tree has the three members of the biopterin-dependent aromatic amino acid hydroxylases in C. elegans , of which CAT-2 is a member, and the predicted homologs in S. stercoralis and S. ratti . B. Co-expression of Ss-cat-2 and Ss-dat-1 in the putative dopaminergic (DA) neurons of S. stercoralis . Montage shows expression of the Ss-cat-2 transcriptional reporter in green, expression of the Ss-dat-1 transcriptional reporter in magenta, and co-expression of the two reporters and the relative positions of these neurons along the body of the iL3 in the differential interference contrast (DIC) overlay. The circles, asterisk, and arrow label the putative Ss- CEP, Ss- ADE, and Ss- PDE neurons, respectively. The iL3 is oriented with the dorsal side facing up and the ventral side facing down; the head is to the left. Scale bar = 100 µm. C-D. Violin plots show expression levels of Ss-cat-2 and Ss-dat-1 , expressed as log 2 counts per million (CPM), at the indicated life stages based on published <t>RNA-seq</t> datasets , , . **** p <0.0001; statistical tests for differential expression analysis were performed as previously described, with corrections for multiple comparisons . FLF = free-living female; iL3 = infective third-stage larva; ppL3 = post-parasitic third-stage larva; PF = parasitic female. Each dot indicates an independent replicate experiment. E. The cat-2 genes of C. elegans and S. stercoralis . Schematics show the gene models of Ce-cat-2 (isoform a), as annotated in WormBase WS292, and Ss-cat-2 . The gene model for Ss-cat-2 was initially derived from WBPS18 and then manually updated to include an additional exon ; the existence of this exon was supported by RNA-seq data , . Exons and introns are depicted as lavender boxes and black lines, respectively. The transcriptional start sites are indicated by black arrows. Ss-cat-2 has a single CRISPR/Cas9 target site, which is located in the second exon (depicted in red). Drawings are to scale and scale bar = 500 bp. F. Inactivation of Ss-cat-2 drastically alters skin-penetration behavior. Tracks show the skin-penetration behaviors of a representative wild-type iL3 that punctured and penetrated the skin and a representative Ss-cat-2 -/- iL3 that punctured but did not complete penetration. Representative worms were defined as in . The key details the behavioral motifs that were tracked. G. Inactivation of Ss-cat-2 severely impairs skin penetration. Bar graphs show the percentage of wild-type and Ss-cat-2 -/- iL3s that completed skin penetration. n = 21 iL3s per genotype. **** p <0.0001, Fisher’s exact test. H. Ss-cat-2 -/- iL3s pushed and punctured the skin for less time than control iL3s. Violin plot depicts the percentage of time on skin that control and Ss-cat-2 -/- iL3s spent engaging in pushes or punctures. n = 20-21 iL3s per genotype. **** p <0.0001, Mann-Whitney test. The iL3s that had initiated penetration by the time the recording started were excluded from this analysis. I. The pushing bouts of Ss-cat-2 -/- iL3s are shorter than those of control iL3s. For each worm, the duration of each individual pushing bout was averaged and then plotted. n = 20 iL3s per genotype. *** p <0.001, Mann-Whitney test. J. Inactivation of Ss-cat-2 inhibits punctures. Violin plot depicts the time taken by control vs. Ss-cat-2 -/- iL3s to puncture the skin for the first time since placement on skin. n = 21 iL3s per genotype. ** p <0.01, Mann-Whitney test. The dotted line at y = 5 indicates the time at which the assay ended; the dots above this line indicate animals that failed to puncture the skin by the end of the assay period. K. Ss-cat-2 -/- iL3s frequently reverse after a push or puncture event. Violin plot shows the percentage of pushes or punctures that were followed by backward locomotion that lasted at least 1 s for each genotype. n = 21 iL3s per genotype. **** p <0.0001, Mann-Whitney test. L. Ss-cat-2 -/- iL3s frequently abort penetration attempts. Violin plot depicts the percentage of penetration attempts, as defined by instances that the worm has punctured and partially entered the skin, that were aborted. n = 11-21 iL3s per genotype. ** p <0.01, Mann-Whitney test. For H-L, dots depict individual worms, dashed lines indicate medians, and dotted lines indicate interquartile ranges. Behavioral parameters plotted in G-L were obtained from 3 independent replicate experiments.
Guide Rna Sequence, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/guide+rna/guide+rna+sequence/bio_rxiv__2025__01__29__635547-214-1-31
Average 90 stars, based on 1 article reviews
guide rna sequence - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

Image Search Results


lncRNA dropout CRISPR-Cas9 screen in MM cell lines. (A) Schematic representation of the CRISPR screening pipeline. (B) Spearman's correlation between pgRNA read count profiles (from DNA collected 30 days after transduction and selection of the library) across screen replicates = 0.85 and 0.88, respectively, for AMO-1 and ABZB, with color bars on top/left indicating cluster membership obtained via hierarchical clustering (complete distance method). (C) Representation of pgRNA abundance log fold changes (logFCs) in DNA collected 30 days after library transduction and selection vs plasmidic amounts for 3 groups of pgRNAs: nontargeting (negative controls [median logFC = 0.27 and 0.35, respectively, for AMO-1 and ABZB]), targeting ribosomal protein genes (control essential genes, median logFC = −0.68 and −0.43, with a logFC ≤−0.5, corresponding to a MAGeCK FDR ≤20%), and lncRNAs, across the 2 screens. Each point represents 1 of the 12 472 pgRNAs in the library with coordinates on the y-axis indicating the median logFC across screen replicates. (D) Gene-wise MAGeCK robust rank aggregation (RRA) scores for significant dependencies identified in the 2 screens at an FDR ≤20%. Top essential control genes, dependencies that are private to each cell line and shared across them (as per the color scheme) are highligted. (E) Number of significantly essential lncRNAs (at an FDR ≤20%) in the 2 screened cell lines and their overlap. MOI, multiplicity of infection.

Journal: Blood

Article Title: An unbiased lncRNA dropout CRISPR-Cas9 screen reveals RP11-350G8.5 as a novel therapeutic target for multiple myeloma ∗

doi: 10.1182/blood.2023021991

Figure Lengend Snippet: lncRNA dropout CRISPR-Cas9 screen in MM cell lines. (A) Schematic representation of the CRISPR screening pipeline. (B) Spearman's correlation between pgRNA read count profiles (from DNA collected 30 days after transduction and selection of the library) across screen replicates = 0.85 and 0.88, respectively, for AMO-1 and ABZB, with color bars on top/left indicating cluster membership obtained via hierarchical clustering (complete distance method). (C) Representation of pgRNA abundance log fold changes (logFCs) in DNA collected 30 days after library transduction and selection vs plasmidic amounts for 3 groups of pgRNAs: nontargeting (negative controls [median logFC = 0.27 and 0.35, respectively, for AMO-1 and ABZB]), targeting ribosomal protein genes (control essential genes, median logFC = −0.68 and −0.43, with a logFC ≤−0.5, corresponding to a MAGeCK FDR ≤20%), and lncRNAs, across the 2 screens. Each point represents 1 of the 12 472 pgRNAs in the library with coordinates on the y-axis indicating the median logFC across screen replicates. (D) Gene-wise MAGeCK robust rank aggregation (RRA) scores for significant dependencies identified in the 2 screens at an FDR ≤20%. Top essential control genes, dependencies that are private to each cell line and shared across them (as per the color scheme) are highligted. (E) Number of significantly essential lncRNAs (at an FDR ≤20%) in the 2 screened cell lines and their overlap. MOI, multiplicity of infection.

Article Snippet: The human paired-guide RNA (pgRNA) library pool ( ) (Addgene number 89640) was used to perform the CRISPR-Cas9 screens (supplemental Materials and methods; , and ).

Techniques: CRISPR, Transduction, Selection, Control, Infection

Functional validation of prioritized oncogenic lncRNA candidates. (A) RP11-350G8.5 and LINC00467 basal expression levels via quantitative real time PCR (qRT-PCR) in MM cell lines and peripheral blood mononuclear cells (PBMCs) from healthy donors (values are normalized to the expression of GAPDH). (B) Representative image of genomic PCR products before and after KO of LINC00467 and RP11-350G8.5 in AMO-1 cells, visualized on 1.5% agarose gels. On the right: Sanger sequence of the amplicons encompassing the CRISPR-targeted region. Blue rectangles highlight pgRNA binding sites, whereas colored lines refer to the schematic picture of the KO reported above the gel picture (on the left). (C) Representative image of flow cytometric monitoring of AMO-1 and ABZB cells transduced with a SCRAMBLE-GFP-CRISPR vector (dark gray) or LINC00467/KO-GFP-CRISPR vector (light blue) or RP11-350G8.5/KO- GFP-CRISPR vector (red). Light-gray curves represent the percentage of viable cells at day 0 (48 hours after lentiviral transduction) with overlapping colored curves at day 20. (D) Representative images of colony assay of AMO-1 and ABZB GFP-sorted cells, 15 days after plating, were generated using EVOS XL-Core microscope (Invitrogen by Thermo Fisher) (magnification ×10). (E) Number of colonies in 3 independent wells. (F) Dose-response curves 24 hours after treatment with bortezomib (1-10 nM). Percentage of viable cells ± standard deviation are normalized with respect to DMSO-treated cells (vehicle) for each experimental condition. Statistical differences were assessed across all plots via Student t test; ∗ P < .05, ∗∗ P < .01, and ∗∗∗ P < .001.

Journal: Blood

Article Title: An unbiased lncRNA dropout CRISPR-Cas9 screen reveals RP11-350G8.5 as a novel therapeutic target for multiple myeloma ∗

doi: 10.1182/blood.2023021991

Figure Lengend Snippet: Functional validation of prioritized oncogenic lncRNA candidates. (A) RP11-350G8.5 and LINC00467 basal expression levels via quantitative real time PCR (qRT-PCR) in MM cell lines and peripheral blood mononuclear cells (PBMCs) from healthy donors (values are normalized to the expression of GAPDH). (B) Representative image of genomic PCR products before and after KO of LINC00467 and RP11-350G8.5 in AMO-1 cells, visualized on 1.5% agarose gels. On the right: Sanger sequence of the amplicons encompassing the CRISPR-targeted region. Blue rectangles highlight pgRNA binding sites, whereas colored lines refer to the schematic picture of the KO reported above the gel picture (on the left). (C) Representative image of flow cytometric monitoring of AMO-1 and ABZB cells transduced with a SCRAMBLE-GFP-CRISPR vector (dark gray) or LINC00467/KO-GFP-CRISPR vector (light blue) or RP11-350G8.5/KO- GFP-CRISPR vector (red). Light-gray curves represent the percentage of viable cells at day 0 (48 hours after lentiviral transduction) with overlapping colored curves at day 20. (D) Representative images of colony assay of AMO-1 and ABZB GFP-sorted cells, 15 days after plating, were generated using EVOS XL-Core microscope (Invitrogen by Thermo Fisher) (magnification ×10). (E) Number of colonies in 3 independent wells. (F) Dose-response curves 24 hours after treatment with bortezomib (1-10 nM). Percentage of viable cells ± standard deviation are normalized with respect to DMSO-treated cells (vehicle) for each experimental condition. Statistical differences were assessed across all plots via Student t test; ∗ P < .05, ∗∗ P < .01, and ∗∗∗ P < .001.

Article Snippet: The human paired-guide RNA (pgRNA) library pool ( ) (Addgene number 89640) was used to perform the CRISPR-Cas9 screens (supplemental Materials and methods; , and ).

Techniques: Functional Assay, Biomarker Discovery, Expressing, Real-time Polymerase Chain Reaction, Quantitative RT-PCR, Sequencing, CRISPR, Binding Assay, Transduction, Plasmid Preparation, Colony Assay, Generated, Microscopy, Standard Deviation

RP11-350G8.5 putative oncogenic role: in vitro validation and preliminary data from in vivo models. (A) Flow cytometric monitoring of GFP expression in ABZB cells transduced with a SCRAMBLE-GFP-CRISPR negative control vector, an RPL8 /KO-GFP-CRISPR positive control vector (selected from Project Score [37]), and 2 GFP-CRISPR constructs encoding for 2 pgRNAs targeting RP11-350G8.5. Gray curves represent the percentage of viable cells at day 0 (48 hours after lentiviral transduction), while colored curves represent the percentage of viable cells at day 20. Bars on the right represent the fold change in percentage of GFP-expressing cells 20 days after target depletion against day 0. (B) Evaluation of IL-6R RNA expression level through quantitative real time PCR (qRT-PCR) on ABZB after transduction with SCRAMBLE vector or KO of RP11-350G8.5 with pgRNA#1 or pgRNA#2 or with a vector overexpressing RP11-350G8.5 (UP). (Data are normalized to the expression of GAPDH.) Statistics were obtained using multiple t -tests, resulting in no significant (ns) differences, as per the reported P values. (C) Flow cytometric monitoring of GFP in JJN.3 and NCI-H929 MM transduced cells, and percentage of GFP-positive cells is reported by overlapping curves referred to day 20 (colored curves) against day 0 (light gray curves). (D) Validation of RP11-350G8.5 KO in nontumoral cells, performed as described for A and C. (E) Representative images of RNA-FISH analysis. Nuclei are counterstained with DAPI (blue signal), whereas C3-fluorescein–conjugated GAPDH (green signal) has been used as cytoplasmic marker. Customly designed Stellaris probes targeting RP11-350G8.5 have been conjugated with 5-carboxytetramethylrhodamine (TAMRA) dye (red signal). Representative pictures acquired with a DMI6000-AF6000 Leica (Wetzlar, Germany) fluorescence microscope at magnification ×63 are reported, followed by specific regions of interest (ROIs), which are represented as enlarged images. (F) Dose-response curves 24 hours after treatment with bortezomib in AMO-1 cells overexpressing RP11-350G8.5 (1-10 nM). Statistics were analyzed using multiple t -tests (cutoff ∗ P < .05, ∗∗ P < .01). (G) In vivo imaging of engrafted ABZB cells. A total of 5 × 10 6 ABZB cells, which previously underwent highly efficient transduction (multiplicity of infection = 1) of RP11-350G8.5 KO-GFP or the SCRAMBLE vectors, were subcutaneously inoculated in mice (n = 2 per group). Images of tumors were acquired when the tumoral masses became palpable (identified as DAY 1), and at the end of the experiment (DAY 16, when tumors reached 2 cm in diameter). Both DAY 1 and DAY 16 were set up by considering SCRAMBLE mice, because SCRAMBLE cells have been faster to generate tumoral masses, due to their higher proliferative rate, and to grow up to 2 cm in diameter, with respect to KO cells. Tumors appear as yellow high-density signals on the right flank of the mice. Pictures were obtained with the IVIS (Perkin Elmer) system. (H) Tumor growth as mean measurement ± standard deviation (SD) across mice groups (n = 2). (I) Photographs of excised tumors were captured by a digital camera. (J) Weights of excised tumors, reported as mean ± SD across mice groups. Statistics were analyzed using multiple t -tests (cutoff: ∗ P < .05).

Journal: Blood

Article Title: An unbiased lncRNA dropout CRISPR-Cas9 screen reveals RP11-350G8.5 as a novel therapeutic target for multiple myeloma ∗

doi: 10.1182/blood.2023021991

Figure Lengend Snippet: RP11-350G8.5 putative oncogenic role: in vitro validation and preliminary data from in vivo models. (A) Flow cytometric monitoring of GFP expression in ABZB cells transduced with a SCRAMBLE-GFP-CRISPR negative control vector, an RPL8 /KO-GFP-CRISPR positive control vector (selected from Project Score [37]), and 2 GFP-CRISPR constructs encoding for 2 pgRNAs targeting RP11-350G8.5. Gray curves represent the percentage of viable cells at day 0 (48 hours after lentiviral transduction), while colored curves represent the percentage of viable cells at day 20. Bars on the right represent the fold change in percentage of GFP-expressing cells 20 days after target depletion against day 0. (B) Evaluation of IL-6R RNA expression level through quantitative real time PCR (qRT-PCR) on ABZB after transduction with SCRAMBLE vector or KO of RP11-350G8.5 with pgRNA#1 or pgRNA#2 or with a vector overexpressing RP11-350G8.5 (UP). (Data are normalized to the expression of GAPDH.) Statistics were obtained using multiple t -tests, resulting in no significant (ns) differences, as per the reported P values. (C) Flow cytometric monitoring of GFP in JJN.3 and NCI-H929 MM transduced cells, and percentage of GFP-positive cells is reported by overlapping curves referred to day 20 (colored curves) against day 0 (light gray curves). (D) Validation of RP11-350G8.5 KO in nontumoral cells, performed as described for A and C. (E) Representative images of RNA-FISH analysis. Nuclei are counterstained with DAPI (blue signal), whereas C3-fluorescein–conjugated GAPDH (green signal) has been used as cytoplasmic marker. Customly designed Stellaris probes targeting RP11-350G8.5 have been conjugated with 5-carboxytetramethylrhodamine (TAMRA) dye (red signal). Representative pictures acquired with a DMI6000-AF6000 Leica (Wetzlar, Germany) fluorescence microscope at magnification ×63 are reported, followed by specific regions of interest (ROIs), which are represented as enlarged images. (F) Dose-response curves 24 hours after treatment with bortezomib in AMO-1 cells overexpressing RP11-350G8.5 (1-10 nM). Statistics were analyzed using multiple t -tests (cutoff ∗ P < .05, ∗∗ P < .01). (G) In vivo imaging of engrafted ABZB cells. A total of 5 × 10 6 ABZB cells, which previously underwent highly efficient transduction (multiplicity of infection = 1) of RP11-350G8.5 KO-GFP or the SCRAMBLE vectors, were subcutaneously inoculated in mice (n = 2 per group). Images of tumors were acquired when the tumoral masses became palpable (identified as DAY 1), and at the end of the experiment (DAY 16, when tumors reached 2 cm in diameter). Both DAY 1 and DAY 16 were set up by considering SCRAMBLE mice, because SCRAMBLE cells have been faster to generate tumoral masses, due to their higher proliferative rate, and to grow up to 2 cm in diameter, with respect to KO cells. Tumors appear as yellow high-density signals on the right flank of the mice. Pictures were obtained with the IVIS (Perkin Elmer) system. (H) Tumor growth as mean measurement ± standard deviation (SD) across mice groups (n = 2). (I) Photographs of excised tumors were captured by a digital camera. (J) Weights of excised tumors, reported as mean ± SD across mice groups. Statistics were analyzed using multiple t -tests (cutoff: ∗ P < .05).

Article Snippet: The human paired-guide RNA (pgRNA) library pool ( ) (Addgene number 89640) was used to perform the CRISPR-Cas9 screens (supplemental Materials and methods; , and ).

Techniques: In Vitro, Biomarker Discovery, In Vivo, Expressing, Transduction, CRISPR, Negative Control, Plasmid Preparation, Positive Control, Construct, RNA Expression, Real-time Polymerase Chain Reaction, Quantitative RT-PCR, Marker, Fluorescence, Microscopy, In Vivo Imaging, Infection, Standard Deviation

The expression levels of CDR1as in periodontal ligament tissues and PDLSCs. (a) The expression of CDR1as in normal tissues ( n = 11) and periodontitis tissues ( n = 10) was determined by RT-qPCR. ∗ p < 0.01 vs. normal. (b) The TNF- α protein level secreted in the medium by PDLSCs treated with LPS was measured with an ELISA kit. Untreated PDLSCs (0 h) were used as control. ∗ p < 0.01 vs. control, ∗∗ p < 0.05 vs. 3 h. (c) IL-8 and IL-18 protein levels secreted in the medium by PDLSCs treated with LPS at 10 μ g/ml for 3 h were measured with an ELISA kit. Untreated PDLSCs were used as control. ∗ p < 0.01 vs. control. (d) The expression levels of CDR1as in LPS-treated PDLSCs were analyzed by RT-qPCR. Untreated PDLSCs were used as control. ∗ p < 0.01 vs. control.

Journal: Mediators of Inflammation

Article Title: circRNA CDR1as Regulated the Proliferation of Human Periodontal Ligament Stem Cells under a Lipopolysaccharide-Induced Inflammatory Condition

doi: 10.1155/2019/1625381

Figure Lengend Snippet: The expression levels of CDR1as in periodontal ligament tissues and PDLSCs. (a) The expression of CDR1as in normal tissues ( n = 11) and periodontitis tissues ( n = 10) was determined by RT-qPCR. ∗ p < 0.01 vs. normal. (b) The TNF- α protein level secreted in the medium by PDLSCs treated with LPS was measured with an ELISA kit. Untreated PDLSCs (0 h) were used as control. ∗ p < 0.01 vs. control, ∗∗ p < 0.05 vs. 3 h. (c) IL-8 and IL-18 protein levels secreted in the medium by PDLSCs treated with LPS at 10 μ g/ml for 3 h were measured with an ELISA kit. Untreated PDLSCs were used as control. ∗ p < 0.01 vs. control. (d) The expression levels of CDR1as in LPS-treated PDLSCs were analyzed by RT-qPCR. Untreated PDLSCs were used as control. ∗ p < 0.01 vs. control.

Article Snippet: The expression plasmid for expressing CDR1as sequence was DNA3.1(+) CircRNA Mini Vector, a gift from Jeremy Wilusz (Addgene plasmid # 60648).

Techniques: Expressing, Quantitative RT-PCR, Enzyme-linked Immunosorbent Assay, Control

circRNA CDR1as mediated LPS-induced inhibition of PDLSC proliferation. (a) A standard curve of cell proliferation and mathematical formula describing OD value and cell number. Cell proliferation of PDLSCs was assessed by CCK-8 assay as indicated with cell numbers in reference to this standard curve obtained under the same conditions in all subsequent experiments. (b) Cell number of LPS-treated PDLSCs was less than that of untreated cells at each examined day, ∗ p < 0.01. (c) The efficiency of knockdown of CDR1as in PDLSCs was determined by RT-qPCR. ∗ p < 0.01 vs. si-NC. (d) The effects of knockdown of CDR1as on the proliferation of PDLSCs. ∗ p < 0.01 vs. control. (e) The efficiency of overexpression of CDR1as in PDLSCs was determined by RT-qPCR. ∗ p < 0.01 vs. over-NC. (f) The effects of overexpression of CDR1as on the proliferation of PDLSCs, ∗ p < 0.01 vs. control.

Journal: Mediators of Inflammation

Article Title: circRNA CDR1as Regulated the Proliferation of Human Periodontal Ligament Stem Cells under a Lipopolysaccharide-Induced Inflammatory Condition

doi: 10.1155/2019/1625381

Figure Lengend Snippet: circRNA CDR1as mediated LPS-induced inhibition of PDLSC proliferation. (a) A standard curve of cell proliferation and mathematical formula describing OD value and cell number. Cell proliferation of PDLSCs was assessed by CCK-8 assay as indicated with cell numbers in reference to this standard curve obtained under the same conditions in all subsequent experiments. (b) Cell number of LPS-treated PDLSCs was less than that of untreated cells at each examined day, ∗ p < 0.01. (c) The efficiency of knockdown of CDR1as in PDLSCs was determined by RT-qPCR. ∗ p < 0.01 vs. si-NC. (d) The effects of knockdown of CDR1as on the proliferation of PDLSCs. ∗ p < 0.01 vs. control. (e) The efficiency of overexpression of CDR1as in PDLSCs was determined by RT-qPCR. ∗ p < 0.01 vs. over-NC. (f) The effects of overexpression of CDR1as on the proliferation of PDLSCs, ∗ p < 0.01 vs. control.

Article Snippet: The expression plasmid for expressing CDR1as sequence was DNA3.1(+) CircRNA Mini Vector, a gift from Jeremy Wilusz (Addgene plasmid # 60648).

Techniques: Inhibition, CCK-8 Assay, Knockdown, Quantitative RT-PCR, Control, Over Expression

CDR1as/miR-7 regulated LPS-induced inhibition of PDLSC proliferation by targeting ERK. (a) The efficiency of transient transduction of miR-7 mimics and miR-7 inhibitor evaluated by RT-qPCR. ∗ p < 0.01 vs. miR-NC. (b) The effects of miR-1 mimic and inhibitor on the proliferation of PDLSCs. After being transfected with miR-NC, miR-7 mimic, or miR-7 inhibitor, PDLSCs were treated with LPS at 10 ng/ μ l for 3 h and cultured for another 3 days with an initial seeding density of 2000 cell/well. Cell proliferation was evaluated by CCK-8 kits. ∗ p < 0.01 vs. miR-NC. (c) Western blot analysis of the protein expression of phospho-ERK, total-ERK, and the internal control GAPDH after transfection with miR-7 mimic, miR-7 inhibitor, or miR-NC. ∗ p < 0.01 vs. miR-NC. (d) Western blot analysis of the protein expression of phospho-ERK, total-ERK, and the internal control GAPDH after transfection with siRNA-CDR1as alone or cotransfected with miR-7 inhibit or miR-7 mimic. ∗ p < 0.01 vs. siRNA-CDR1as. (e) The effects of siRNA-CDR1as cotransfected with miR-7 inhibit or miR-7 mimic on the cell proliferation of PDLSCs. ∗ p < 0.05 vs. siRNA-CDR1as.

Journal: Mediators of Inflammation

Article Title: circRNA CDR1as Regulated the Proliferation of Human Periodontal Ligament Stem Cells under a Lipopolysaccharide-Induced Inflammatory Condition

doi: 10.1155/2019/1625381

Figure Lengend Snippet: CDR1as/miR-7 regulated LPS-induced inhibition of PDLSC proliferation by targeting ERK. (a) The efficiency of transient transduction of miR-7 mimics and miR-7 inhibitor evaluated by RT-qPCR. ∗ p < 0.01 vs. miR-NC. (b) The effects of miR-1 mimic and inhibitor on the proliferation of PDLSCs. After being transfected with miR-NC, miR-7 mimic, or miR-7 inhibitor, PDLSCs were treated with LPS at 10 ng/ μ l for 3 h and cultured for another 3 days with an initial seeding density of 2000 cell/well. Cell proliferation was evaluated by CCK-8 kits. ∗ p < 0.01 vs. miR-NC. (c) Western blot analysis of the protein expression of phospho-ERK, total-ERK, and the internal control GAPDH after transfection with miR-7 mimic, miR-7 inhibitor, or miR-NC. ∗ p < 0.01 vs. miR-NC. (d) Western blot analysis of the protein expression of phospho-ERK, total-ERK, and the internal control GAPDH after transfection with siRNA-CDR1as alone or cotransfected with miR-7 inhibit or miR-7 mimic. ∗ p < 0.01 vs. siRNA-CDR1as. (e) The effects of siRNA-CDR1as cotransfected with miR-7 inhibit or miR-7 mimic on the cell proliferation of PDLSCs. ∗ p < 0.05 vs. siRNA-CDR1as.

Article Snippet: The expression plasmid for expressing CDR1as sequence was DNA3.1(+) CircRNA Mini Vector, a gift from Jeremy Wilusz (Addgene plasmid # 60648).

Techniques: Inhibition, Transduction, Quantitative RT-PCR, Transfection, Cell Culture, CCK-8 Assay, Western Blot, Expressing, Control

A. Phylogenetic analysis shows the closest homologs of C. elegans CAT-2 (gray) in S. stercoralis (brown) and S. ratti (blue). Putative homologs in each genome were identified by performing TBLASTN searches of the C. elegans CAT-2A protein sequence (i.e ., the longest isoform) against either the S. stercoralis genome or the S. ratti genome in WormBase ParaSite WBPS18. The tree has the three members of the biopterin-dependent aromatic amino acid hydroxylases in C. elegans , of which CAT-2 is a member, and the predicted homologs in S. stercoralis and S. ratti . B. Co-expression of Ss-cat-2 and Ss-dat-1 in the putative dopaminergic (DA) neurons of S. stercoralis . Montage shows expression of the Ss-cat-2 transcriptional reporter in green, expression of the Ss-dat-1 transcriptional reporter in magenta, and co-expression of the two reporters and the relative positions of these neurons along the body of the iL3 in the differential interference contrast (DIC) overlay. The circles, asterisk, and arrow label the putative Ss- CEP, Ss- ADE, and Ss- PDE neurons, respectively. The iL3 is oriented with the dorsal side facing up and the ventral side facing down; the head is to the left. Scale bar = 100 µm. C-D. Violin plots show expression levels of Ss-cat-2 and Ss-dat-1 , expressed as log 2 counts per million (CPM), at the indicated life stages based on published RNA-seq datasets , , . **** p <0.0001; statistical tests for differential expression analysis were performed as previously described, with corrections for multiple comparisons . FLF = free-living female; iL3 = infective third-stage larva; ppL3 = post-parasitic third-stage larva; PF = parasitic female. Each dot indicates an independent replicate experiment. E. The cat-2 genes of C. elegans and S. stercoralis . Schematics show the gene models of Ce-cat-2 (isoform a), as annotated in WormBase WS292, and Ss-cat-2 . The gene model for Ss-cat-2 was initially derived from WBPS18 and then manually updated to include an additional exon ; the existence of this exon was supported by RNA-seq data , . Exons and introns are depicted as lavender boxes and black lines, respectively. The transcriptional start sites are indicated by black arrows. Ss-cat-2 has a single CRISPR/Cas9 target site, which is located in the second exon (depicted in red). Drawings are to scale and scale bar = 500 bp. F. Inactivation of Ss-cat-2 drastically alters skin-penetration behavior. Tracks show the skin-penetration behaviors of a representative wild-type iL3 that punctured and penetrated the skin and a representative Ss-cat-2 -/- iL3 that punctured but did not complete penetration. Representative worms were defined as in . The key details the behavioral motifs that were tracked. G. Inactivation of Ss-cat-2 severely impairs skin penetration. Bar graphs show the percentage of wild-type and Ss-cat-2 -/- iL3s that completed skin penetration. n = 21 iL3s per genotype. **** p <0.0001, Fisher’s exact test. H. Ss-cat-2 -/- iL3s pushed and punctured the skin for less time than control iL3s. Violin plot depicts the percentage of time on skin that control and Ss-cat-2 -/- iL3s spent engaging in pushes or punctures. n = 20-21 iL3s per genotype. **** p <0.0001, Mann-Whitney test. The iL3s that had initiated penetration by the time the recording started were excluded from this analysis. I. The pushing bouts of Ss-cat-2 -/- iL3s are shorter than those of control iL3s. For each worm, the duration of each individual pushing bout was averaged and then plotted. n = 20 iL3s per genotype. *** p <0.001, Mann-Whitney test. J. Inactivation of Ss-cat-2 inhibits punctures. Violin plot depicts the time taken by control vs. Ss-cat-2 -/- iL3s to puncture the skin for the first time since placement on skin. n = 21 iL3s per genotype. ** p <0.01, Mann-Whitney test. The dotted line at y = 5 indicates the time at which the assay ended; the dots above this line indicate animals that failed to puncture the skin by the end of the assay period. K. Ss-cat-2 -/- iL3s frequently reverse after a push or puncture event. Violin plot shows the percentage of pushes or punctures that were followed by backward locomotion that lasted at least 1 s for each genotype. n = 21 iL3s per genotype. **** p <0.0001, Mann-Whitney test. L. Ss-cat-2 -/- iL3s frequently abort penetration attempts. Violin plot depicts the percentage of penetration attempts, as defined by instances that the worm has punctured and partially entered the skin, that were aborted. n = 11-21 iL3s per genotype. ** p <0.01, Mann-Whitney test. For H-L, dots depict individual worms, dashed lines indicate medians, and dotted lines indicate interquartile ranges. Behavioral parameters plotted in G-L were obtained from 3 independent replicate experiments.

Journal: bioRxiv

Article Title: Dopamine signaling drives skin invasion by human-infective nematodes

doi: 10.1101/2025.01.29.635547

Figure Lengend Snippet: A. Phylogenetic analysis shows the closest homologs of C. elegans CAT-2 (gray) in S. stercoralis (brown) and S. ratti (blue). Putative homologs in each genome were identified by performing TBLASTN searches of the C. elegans CAT-2A protein sequence (i.e ., the longest isoform) against either the S. stercoralis genome or the S. ratti genome in WormBase ParaSite WBPS18. The tree has the three members of the biopterin-dependent aromatic amino acid hydroxylases in C. elegans , of which CAT-2 is a member, and the predicted homologs in S. stercoralis and S. ratti . B. Co-expression of Ss-cat-2 and Ss-dat-1 in the putative dopaminergic (DA) neurons of S. stercoralis . Montage shows expression of the Ss-cat-2 transcriptional reporter in green, expression of the Ss-dat-1 transcriptional reporter in magenta, and co-expression of the two reporters and the relative positions of these neurons along the body of the iL3 in the differential interference contrast (DIC) overlay. The circles, asterisk, and arrow label the putative Ss- CEP, Ss- ADE, and Ss- PDE neurons, respectively. The iL3 is oriented with the dorsal side facing up and the ventral side facing down; the head is to the left. Scale bar = 100 µm. C-D. Violin plots show expression levels of Ss-cat-2 and Ss-dat-1 , expressed as log 2 counts per million (CPM), at the indicated life stages based on published RNA-seq datasets , , . **** p <0.0001; statistical tests for differential expression analysis were performed as previously described, with corrections for multiple comparisons . FLF = free-living female; iL3 = infective third-stage larva; ppL3 = post-parasitic third-stage larva; PF = parasitic female. Each dot indicates an independent replicate experiment. E. The cat-2 genes of C. elegans and S. stercoralis . Schematics show the gene models of Ce-cat-2 (isoform a), as annotated in WormBase WS292, and Ss-cat-2 . The gene model for Ss-cat-2 was initially derived from WBPS18 and then manually updated to include an additional exon ; the existence of this exon was supported by RNA-seq data , . Exons and introns are depicted as lavender boxes and black lines, respectively. The transcriptional start sites are indicated by black arrows. Ss-cat-2 has a single CRISPR/Cas9 target site, which is located in the second exon (depicted in red). Drawings are to scale and scale bar = 500 bp. F. Inactivation of Ss-cat-2 drastically alters skin-penetration behavior. Tracks show the skin-penetration behaviors of a representative wild-type iL3 that punctured and penetrated the skin and a representative Ss-cat-2 -/- iL3 that punctured but did not complete penetration. Representative worms were defined as in . The key details the behavioral motifs that were tracked. G. Inactivation of Ss-cat-2 severely impairs skin penetration. Bar graphs show the percentage of wild-type and Ss-cat-2 -/- iL3s that completed skin penetration. n = 21 iL3s per genotype. **** p <0.0001, Fisher’s exact test. H. Ss-cat-2 -/- iL3s pushed and punctured the skin for less time than control iL3s. Violin plot depicts the percentage of time on skin that control and Ss-cat-2 -/- iL3s spent engaging in pushes or punctures. n = 20-21 iL3s per genotype. **** p <0.0001, Mann-Whitney test. The iL3s that had initiated penetration by the time the recording started were excluded from this analysis. I. The pushing bouts of Ss-cat-2 -/- iL3s are shorter than those of control iL3s. For each worm, the duration of each individual pushing bout was averaged and then plotted. n = 20 iL3s per genotype. *** p <0.001, Mann-Whitney test. J. Inactivation of Ss-cat-2 inhibits punctures. Violin plot depicts the time taken by control vs. Ss-cat-2 -/- iL3s to puncture the skin for the first time since placement on skin. n = 21 iL3s per genotype. ** p <0.01, Mann-Whitney test. The dotted line at y = 5 indicates the time at which the assay ended; the dots above this line indicate animals that failed to puncture the skin by the end of the assay period. K. Ss-cat-2 -/- iL3s frequently reverse after a push or puncture event. Violin plot shows the percentage of pushes or punctures that were followed by backward locomotion that lasted at least 1 s for each genotype. n = 21 iL3s per genotype. **** p <0.0001, Mann-Whitney test. L. Ss-cat-2 -/- iL3s frequently abort penetration attempts. Violin plot depicts the percentage of penetration attempts, as defined by instances that the worm has punctured and partially entered the skin, that were aborted. n = 11-21 iL3s per genotype. ** p <0.01, Mann-Whitney test. For H-L, dots depict individual worms, dashed lines indicate medians, and dotted lines indicate interquartile ranges. Behavioral parameters plotted in G-L were obtained from 3 independent replicate experiments.

Article Snippet: This guide RNA sequence was synthesized and fused with the promoter of the S. ratti U6 gene, the sequence of the sgRNA scaffold, and the S. ratti U6 3′ UTR by GenScript, as previously described .

Techniques: Sequencing, Expressing, RNA Sequencing Assay, Derivative Assay, CRISPR, Control, MANN-WHITNEY

A. Phylogenetic analysis shows the closest homologs of C. elegans TRP-4 (gray) in S. stercoralis (brown). Putative homologs in each genome were identified by performing TBLASTN searches of the C. elegans TRP-4 protein sequence against the S. stercoralis genome in WBPS18. The tree has all known TRP family members in C. elegans - and the predicted homologs in S. stercoralis . B. Co-expression of Ss-trp-4 and Ss-dat-1 in the putative dopaminergic (DA) neurons of S. stercoralis . Montage shows expression of the Ss-trp-4 transcriptional reporter in green, expression of the Ss-dat-1 transcriptional reporter in magenta, and co-expression of the two reporters and the relative positions of these neurons along the body of the iL3 in the DIC overlay. The circles, asterisk, and arrow label the putative Ss- CEP, Ss- ADE, and Ss- PDE neurons, respectively; we never observed expression of the Ss-trp-4 reporter in Ss- PDE. The iL3 is oriented with the dorsal side facing up and head to the left. Scale bar = 100 µm. C. Violin plot shows expression levels of Ss-trp-4 , expressed as log 2 counts per million (CPM), in the indicated life stages based on published RNA-seq datasets , , . **** p <0.0001; statistical tests for differential expression analysis were performed as previously described, with corrections for multiple comparisons . FLF = free-living female; iL3 = infective third-stage larva; ppL3 = post-parasitic third-stage larva; PF = parasitic female. Each dot indicates an independent replicate experiment. D. The trp-4 genes of C. elegans and S. stercoralis . Schematics show the gene models of Ce-trp-4 and Ss-trp-4 , which were derived from annotations in WS292 and WBPS18, respectively. Notably, the Ss-trp-4 gene model has a 5′ UTR that is not annotated in WBPS18 but is supported by published RNA-seq data , . Exons, introns, and UTRs are depicted as pink boxes, black lines, and gray boxes, respectively. The transcriptional start sites are indicated by black arrows. Ss-trp-4 has two CRISPR/Cas9 target sites in the first exon, which are depicted in red; we used two distinct sgRNAs, one targeting each CRISPR site, to inactivate Ss-trp-4 and generate a mutant stable line. Drawings are to scale and scale bar = 1000 bp. E. Ss-trp-4 mutants have reduced skin-penetration drive. Tracks show the skin-penetration behaviors of a representative wild-type iL3 that punctured and completed penetration and a representative Ss-trp-4 -/- iL3 that neither punctured nor completed penetration. Representative worms were defined as in . The key details the behavioral motifs that were tracked. F. Inactivation of Ss-trp-4 severely inhibits skin penetration. Bar graph shows the percentage of wild-type and Ss-trp-4 -/- iL3s that completed skin penetration. n = 24 iL3s per genotype. **** p <0.0001, Fisher’s exact test. G. Ss-trp-4 -/- iL3s pushed and punctured the skin for less time than control worms. Violin plot depicts the percentage of time on skin that control and Ss-trp-4 -/- iL3s spent engaging in pushes or punctures. n = 23-24 iL3s per genotype. **** p <0.0001, Mann-Whitney test. The iL3s that had initiated penetration by the time the recording started were excluded from this analysis. H. The pushing bouts of Ss-trp-4 -/- iL3s are shorter than those of control iL3s. For each worm, the duration of each individual pushing bout was averaged and then plotted. n = 23 iL3s per genotype. ** p <0.01, Mann-Whitney test. I. Inactivation of Ss-trp-4 inhibits punctures. Violin plot depicts the time taken by control vs. Ss-trp-4 -/- iL3s to puncture the skin for the first time since placement on skin. n = 24 iL3s per genotype. **** p <0.0001, Mann-Whitney test. The dotted line at y = 5 indicates the time at which the assay ended; the dots above this line indicate animals that failed to puncture the skin by the end of the assay. J. Ss-trp-4 -/- iL3s frequently reverse after a push or puncture event. Violin plot shows the percentage of pushes or punctures that were followed by backward locomotion that lasted at least 1 s for each genotype. n = 23-24 iL3s per genotype. *** p <0.001, Mann-Whitney test. K. Ss-trp-4 -/- iL3s frequently abort penetration attempts. Violin plot depicts the percentage of penetration attempts, as defined by instances that the worm has punctured and partially entered the skin, that were aborted. n = 9-24 iL3s per genotype. *** p <0.001, Mann-Whitney test. For G-K, dots depict individual worms, dashed lines indicate the median, and dotted lines indicate the interquartile range. Behavioral parameters plotted in F-K were obtained from 3 independent replicate experiments.

Journal: bioRxiv

Article Title: Dopamine signaling drives skin invasion by human-infective nematodes

doi: 10.1101/2025.01.29.635547

Figure Lengend Snippet: A. Phylogenetic analysis shows the closest homologs of C. elegans TRP-4 (gray) in S. stercoralis (brown). Putative homologs in each genome were identified by performing TBLASTN searches of the C. elegans TRP-4 protein sequence against the S. stercoralis genome in WBPS18. The tree has all known TRP family members in C. elegans - and the predicted homologs in S. stercoralis . B. Co-expression of Ss-trp-4 and Ss-dat-1 in the putative dopaminergic (DA) neurons of S. stercoralis . Montage shows expression of the Ss-trp-4 transcriptional reporter in green, expression of the Ss-dat-1 transcriptional reporter in magenta, and co-expression of the two reporters and the relative positions of these neurons along the body of the iL3 in the DIC overlay. The circles, asterisk, and arrow label the putative Ss- CEP, Ss- ADE, and Ss- PDE neurons, respectively; we never observed expression of the Ss-trp-4 reporter in Ss- PDE. The iL3 is oriented with the dorsal side facing up and head to the left. Scale bar = 100 µm. C. Violin plot shows expression levels of Ss-trp-4 , expressed as log 2 counts per million (CPM), in the indicated life stages based on published RNA-seq datasets , , . **** p <0.0001; statistical tests for differential expression analysis were performed as previously described, with corrections for multiple comparisons . FLF = free-living female; iL3 = infective third-stage larva; ppL3 = post-parasitic third-stage larva; PF = parasitic female. Each dot indicates an independent replicate experiment. D. The trp-4 genes of C. elegans and S. stercoralis . Schematics show the gene models of Ce-trp-4 and Ss-trp-4 , which were derived from annotations in WS292 and WBPS18, respectively. Notably, the Ss-trp-4 gene model has a 5′ UTR that is not annotated in WBPS18 but is supported by published RNA-seq data , . Exons, introns, and UTRs are depicted as pink boxes, black lines, and gray boxes, respectively. The transcriptional start sites are indicated by black arrows. Ss-trp-4 has two CRISPR/Cas9 target sites in the first exon, which are depicted in red; we used two distinct sgRNAs, one targeting each CRISPR site, to inactivate Ss-trp-4 and generate a mutant stable line. Drawings are to scale and scale bar = 1000 bp. E. Ss-trp-4 mutants have reduced skin-penetration drive. Tracks show the skin-penetration behaviors of a representative wild-type iL3 that punctured and completed penetration and a representative Ss-trp-4 -/- iL3 that neither punctured nor completed penetration. Representative worms were defined as in . The key details the behavioral motifs that were tracked. F. Inactivation of Ss-trp-4 severely inhibits skin penetration. Bar graph shows the percentage of wild-type and Ss-trp-4 -/- iL3s that completed skin penetration. n = 24 iL3s per genotype. **** p <0.0001, Fisher’s exact test. G. Ss-trp-4 -/- iL3s pushed and punctured the skin for less time than control worms. Violin plot depicts the percentage of time on skin that control and Ss-trp-4 -/- iL3s spent engaging in pushes or punctures. n = 23-24 iL3s per genotype. **** p <0.0001, Mann-Whitney test. The iL3s that had initiated penetration by the time the recording started were excluded from this analysis. H. The pushing bouts of Ss-trp-4 -/- iL3s are shorter than those of control iL3s. For each worm, the duration of each individual pushing bout was averaged and then plotted. n = 23 iL3s per genotype. ** p <0.01, Mann-Whitney test. I. Inactivation of Ss-trp-4 inhibits punctures. Violin plot depicts the time taken by control vs. Ss-trp-4 -/- iL3s to puncture the skin for the first time since placement on skin. n = 24 iL3s per genotype. **** p <0.0001, Mann-Whitney test. The dotted line at y = 5 indicates the time at which the assay ended; the dots above this line indicate animals that failed to puncture the skin by the end of the assay. J. Ss-trp-4 -/- iL3s frequently reverse after a push or puncture event. Violin plot shows the percentage of pushes or punctures that were followed by backward locomotion that lasted at least 1 s for each genotype. n = 23-24 iL3s per genotype. *** p <0.001, Mann-Whitney test. K. Ss-trp-4 -/- iL3s frequently abort penetration attempts. Violin plot depicts the percentage of penetration attempts, as defined by instances that the worm has punctured and partially entered the skin, that were aborted. n = 9-24 iL3s per genotype. *** p <0.001, Mann-Whitney test. For G-K, dots depict individual worms, dashed lines indicate the median, and dotted lines indicate the interquartile range. Behavioral parameters plotted in F-K were obtained from 3 independent replicate experiments.

Article Snippet: This guide RNA sequence was synthesized and fused with the promoter of the S. ratti U6 gene, the sequence of the sgRNA scaffold, and the S. ratti U6 3′ UTR by GenScript, as previously described .

Techniques: Sequencing, Expressing, RNA Sequencing Assay, Derivative Assay, CRISPR, Mutagenesis, Control, MANN-WHITNEY