Journal: Mediators of Inflammation

Article Title: circRNA CDR1as Regulated the Proliferation of Human Periodontal Ligament Stem Cells under a Lipopolysaccharide-Induced Inflammatory Condition

doi: 10.1155/2019/1625381

Figure Lengend Snippet: The expression levels of CDR1as in periodontal ligament tissues and PDLSCs. (a) The expression of CDR1as in normal tissues ( n = 11) and periodontitis tissues ( n = 10) was determined by RT-qPCR. ∗ p < 0.01 vs. normal. (b) The TNF- α protein level secreted in the medium by PDLSCs treated with LPS was measured with an ELISA kit. Untreated PDLSCs (0 h) were used as control. ∗ p < 0.01 vs. control, ∗∗ p < 0.05 vs. 3 h. (c) IL-8 and IL-18 protein levels secreted in the medium by PDLSCs treated with LPS at 10 μ g/ml for 3 h were measured with an ELISA kit. Untreated PDLSCs were used as control. ∗ p < 0.01 vs. control. (d) The expression levels of CDR1as in LPS-treated PDLSCs were analyzed by RT-qPCR. Untreated PDLSCs were used as control. ∗ p < 0.01 vs. control.

Article Snippet: The expression plasmid for expressing CDR1as sequence was DNA3.1(+) CircRNA Mini Vector, a gift from Jeremy Wilusz (Addgene plasmid # 60648).

Techniques: Expressing, Quantitative RT-PCR, Enzyme-linked Immunosorbent Assay, Control

Journal: Mediators of Inflammation

Article Title: circRNA CDR1as Regulated the Proliferation of Human Periodontal Ligament Stem Cells under a Lipopolysaccharide-Induced Inflammatory Condition

doi: 10.1155/2019/1625381

Figure Lengend Snippet: circRNA CDR1as mediated LPS-induced inhibition of PDLSC proliferation. (a) A standard curve of cell proliferation and mathematical formula describing OD value and cell number. Cell proliferation of PDLSCs was assessed by CCK-8 assay as indicated with cell numbers in reference to this standard curve obtained under the same conditions in all subsequent experiments. (b) Cell number of LPS-treated PDLSCs was less than that of untreated cells at each examined day, ∗ p < 0.01. (c) The efficiency of knockdown of CDR1as in PDLSCs was determined by RT-qPCR. ∗ p < 0.01 vs. si-NC. (d) The effects of knockdown of CDR1as on the proliferation of PDLSCs. ∗ p < 0.01 vs. control. (e) The efficiency of overexpression of CDR1as in PDLSCs was determined by RT-qPCR. ∗ p < 0.01 vs. over-NC. (f) The effects of overexpression of CDR1as on the proliferation of PDLSCs, ∗ p < 0.01 vs. control.

Article Snippet: The expression plasmid for expressing CDR1as sequence was DNA3.1(+) CircRNA Mini Vector, a gift from Jeremy Wilusz (Addgene plasmid # 60648).

Techniques: Inhibition, CCK-8 Assay, Knockdown, Quantitative RT-PCR, Control, Over Expression

Journal: Mediators of Inflammation

Article Title: circRNA CDR1as Regulated the Proliferation of Human Periodontal Ligament Stem Cells under a Lipopolysaccharide-Induced Inflammatory Condition

doi: 10.1155/2019/1625381

Figure Lengend Snippet: CDR1as/miR-7 regulated LPS-induced inhibition of PDLSC proliferation by targeting ERK. (a) The efficiency of transient transduction of miR-7 mimics and miR-7 inhibitor evaluated by RT-qPCR. ∗ p < 0.01 vs. miR-NC. (b) The effects of miR-1 mimic and inhibitor on the proliferation of PDLSCs. After being transfected with miR-NC, miR-7 mimic, or miR-7 inhibitor, PDLSCs were treated with LPS at 10 ng/ μ l for 3 h and cultured for another 3 days with an initial seeding density of 2000 cell/well. Cell proliferation was evaluated by CCK-8 kits. ∗ p < 0.01 vs. miR-NC. (c) Western blot analysis of the protein expression of phospho-ERK, total-ERK, and the internal control GAPDH after transfection with miR-7 mimic, miR-7 inhibitor, or miR-NC. ∗ p < 0.01 vs. miR-NC. (d) Western blot analysis of the protein expression of phospho-ERK, total-ERK, and the internal control GAPDH after transfection with siRNA-CDR1as alone or cotransfected with miR-7 inhibit or miR-7 mimic. ∗ p < 0.01 vs. siRNA-CDR1as. (e) The effects of siRNA-CDR1as cotransfected with miR-7 inhibit or miR-7 mimic on the cell proliferation of PDLSCs. ∗ p < 0.05 vs. siRNA-CDR1as.

Article Snippet: The expression plasmid for expressing CDR1as sequence was DNA3.1(+) CircRNA Mini Vector, a gift from Jeremy Wilusz (Addgene plasmid # 60648).

Techniques: Inhibition, Transduction, Quantitative RT-PCR, Transfection, Cell Culture, CCK-8 Assay, Western Blot, Expressing, Control

Journal: Bone

Article Title: A role for G protein-coupled receptor 137b in bone remodeling in mouse and zebrafish

doi: 10.1016/j.bone.2019.06.002

Figure Lengend Snippet: (A) Schematic of the Gpr137b gene indicating the gRNA target site on exon 1. (B-G) Differentiated Hoxb8 cells transduced with gRNA lentivirus. (B) Heteroduplex PCR followed by T7 Endonuclease I digestion detailing the presence of site-specific modification in the cells transduced with gRNA. (C) Western blot from membrane protein-enriched extracts showing GPR137b and LAMP-1 protein expression in control (eGFP) and transduced (Gpr137B−/−) cells. (D) Representative picture showing Hoxb8::eGFP and Hoxb8::gRNA gpr137b−/− cells differentiated on plastic and stained for TRAP activity. Scale bar 200μm. (E) Graph showing number of TRAP+ cells with 3 or more nuclei counted per cultured well and the average size of TRAP+ cells per well. (F-G) Hoxb8::eGFP and Hoxb8::gRNA gpr137b−/− were differentiated on osteo-assay plates. Cells were removed and the matrix was stained with von Kossa and pyrogallol to visualize the resorbtion pits (white spots). (F) Representative picture showing the matrix stained after 10 days of culture. Scale bar 500 μm. (G) Graph showing the quantification of resorbed area per well. Graphs represent mean±SD, **p<0.01, ****p<0.0001 determined by unpaired Student’s t-test or Mann Whitney test.

Article Snippet: Lentivirus encoding a guide RNA (gRNA) for Gpr137b (CGTGAAGCTCGGCCTCACCG) or EGFP control (GAAGTTCGAGGGCGACACCC) were generated by the Broad Institute Genetic Perturbation Platform (Cambridge, MA) using the pXPR_003 vector.

Techniques: Transduction, Modification, Western Blot, Membrane, Expressing, Control, Staining, Activity Assay, Cell Culture, MANN-WHITNEY